Table 1 The primer sequences for qRT-PCR and PCR condition used for the miR-181a and miR-181b and GAPDH gene
From: miR-155 and miR-92 levels in ALL, post-transplant aGVHD, and CMV: possible new treatment options
Gene | Primer sequences | Thermocycling condition |
|---|---|---|
GAPDH | Forward GGACTCATGACCACAGTCCA Reverse CCAGTAGAGGCAGGGATGAT | 95 °C/2 min, 40 cycles of 95 °C/30 s, 57.5 °C/20 s, and 70 °C/30 s |
MIR-92a | Forward GTGCAGGGTCCGAGGT Reverse GTGCAGGGTCCGAGGT | 94 °C/2 min, 40 cycles of 94 °C/30 s, 57 °C/20 s, and 70 °C/30 s |
MIR-155 | Forward GCTACTCCTACATATTAGCA Reverse GTGCAGGGTCCGAGGT | 95 °C/2 min, 40 cycles of 95 °C/30 s, 58 °C/20 s, and 70 °C/30 s |